diff options
| author | Matt A. Tobin <mattatobin@localhost.localdomain> | 2018-02-02 04:16:08 -0500 |
|---|---|---|
| committer | Matt A. Tobin <mattatobin@localhost.localdomain> | 2018-02-02 04:16:08 -0500 |
| commit | 5f8de423f190bbb79a62f804151bc24824fa32d8 (patch) | |
| tree | 10027f336435511475e392454359edea8e25895d /build/pgo/js-input/sunspider/string-fasta.html | |
| parent | 49ee0794b5d912db1f95dce6eb52d781dc210db5 (diff) | |
| download | UXP-5f8de423f190bbb79a62f804151bc24824fa32d8.tar UXP-5f8de423f190bbb79a62f804151bc24824fa32d8.tar.gz UXP-5f8de423f190bbb79a62f804151bc24824fa32d8.tar.lz UXP-5f8de423f190bbb79a62f804151bc24824fa32d8.tar.xz UXP-5f8de423f190bbb79a62f804151bc24824fa32d8.zip | |
Add m-esr52 at 52.6.0
Diffstat (limited to 'build/pgo/js-input/sunspider/string-fasta.html')
| -rw-r--r-- | build/pgo/js-input/sunspider/string-fasta.html | 135 |
1 files changed, 135 insertions, 0 deletions
diff --git a/build/pgo/js-input/sunspider/string-fasta.html b/build/pgo/js-input/sunspider/string-fasta.html new file mode 100644 index 000000000..240e60147 --- /dev/null +++ b/build/pgo/js-input/sunspider/string-fasta.html @@ -0,0 +1,135 @@ +<!DOCTYPE html> +<head> +<!-- + Copyright (C) 2007 Apple Inc. All rights reserved. + + Redistribution and use in source and binary forms, with or without + modification, are permitted provided that the following conditions + are met: + 1. Redistributions of source code must retain the above copyright + notice, this list of conditions and the following disclaimer. + 2. Redistributions in binary form must reproduce the above copyright + notice, this list of conditions and the following disclaimer in the + documentation and/or other materials provided with the distribution. + + THIS SOFTWARE IS PROVIDED BY APPLE COMPUTER, INC. ``AS IS'' AND ANY + EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE + IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR + PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL APPLE COMPUTER, INC. OR + CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, + EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, + PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR + PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY + OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT + (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE + OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. +--> + +<title>SunSpider string-fasta</title> + +</head> + +<body> +<h3>string-fasta</h3> +<div id="console"> +</div> + +<script> + +var _sunSpiderStartDate = new Date(); + +// The Great Computer Language Shootout +// http://shootout.alioth.debian.org +// +// Contributed by Ian Osgood + +var last = 42, A = 3877, C = 29573, M = 139968; + +function rand(max) { + last = (last * A + C) % M; + return max * last / M; +} + +var ALU = + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; + +var IUB = { + a:0.27, c:0.12, g:0.12, t:0.27, + B:0.02, D:0.02, H:0.02, K:0.02, + M:0.02, N:0.02, R:0.02, S:0.02, + V:0.02, W:0.02, Y:0.02 +} + +var HomoSap = { + a: 0.3029549426680, + c: 0.1979883004921, + g: 0.1975473066391, + t: 0.3015094502008 +} + +function makeCumulative(table) { + var last = null; + for (var c in table) { + if (last) table[c] += table[last]; + last = c; + } +} + +function fastaRepeat(n, seq) { + var seqi = 0, lenOut = 60; + while (n>0) { + if (n<lenOut) lenOut = n; + if (seqi + lenOut < seq.length) { + ret = seq.substring(seqi, seqi+lenOut); + seqi += lenOut; + } else { + var s = seq.substring(seqi); + seqi = lenOut - s.length; + ret = s + seq.substring(0, seqi); + } + n -= lenOut; + } +} + +function fastaRandom(n, table) { + var line = new Array(60); + makeCumulative(table); + while (n>0) { + if (n<line.length) line = new Array(n); + for (var i=0; i<line.length; i++) { + var r = rand(1); + for (var c in table) { + if (r < table[c]) { + line[i] = c; + break; + } + } + } + ret = line.join(''); + n -= line.length; + } +} + +var ret; + +var count = 7; +ret = fastaRepeat(2*count*100000, ALU); +ret = fastaRandom(3*count*1000, IUB); +ret = fastaRandom(5*count*1000, HomoSap); + + + +var _sunSpiderInterval = new Date() - _sunSpiderStartDate; + +document.getElementById("console").innerHTML = _sunSpiderInterval; +</script> + + +</body> +</html> |